Hoax!

The Piltdown Hoax.

          It all started in the early 1900's. In the year 1912, in a small village of Piltdown, amateur archaeologist, Charles Dawson, was digging in a gravel pit and claimed that he found a piece of ancient human skull. After his discovery he invited a leading English geologist Arthur Woodward and a french paleontologist Father Pier, to join him with his work.  Later Dawson claim to have found more fossils this one seemed like a jaw bone, apparently from the same skull. The jaw appeared to be an ape jaw. This was truly shocking to the people. There human remains found in neighboring countries such as France, but there had never been anything found in England. The discovery of various fossils made people believe that it was all true. People who didn't think it was true were afraid to say anything against it. The pieces found by Dawson and his colleagues were kept under a lock and a key in a museum. It seemed like the missing link between humans and apes was found. This appeared to be solid evidence (at the time) that there was human life which evolved.
     But it was not very long before this great discovery was put in question. There were more fossils being discovered in such places as Asia and other places, and these fossils resembled human remains far more than Dawson's discoveries. But since Dawson's discoveries were kept under tight security it lacked much investigation which it needed to be verified. But the turning point came after WWII. In 1949 scientists were exposed to better and more advanced technology. They could measure the fluorine content of the object to date it. In 1949 that is what they did to the jaw bone which Dawson belonged to an ancient human skull. They found that the remains were rather young. It made no sense to have fossils so young, because ancient human remains should not be young, but this remain was less than a 100 years old. They found that the staining on the fossils was superficial, the artifacts were stained as well and that there was material that was cut using a steel knife. After further examination scientists also found that there was evidence that fossils were filed out, the teeth were filed down to fit a certain shape, there were scratches all over, it was declared that the remain belonged to a female orangutan. All evidence point to one conclusion that someone had faked this whole “discovery” and the prime suspect was Charles Dawson, who initially had claimed to have found these fossils.
       Although one can claim that Dawson is only human, that he made an innocent mistake. Others could claim that he had an inferior motive to gain scientific prestige. But lets just take the first perspective to mind. Dawson was a human being and we as human beings are capable of doing more wrong than right. A scientist belongs to the same homo sapien species as any other human being. Their profession does not exclude, or teach them how to error less, it is all innate. Mistakes are made all the time, even by the most experts, or the most witty ones. Making mistakes is a factor that can not be removed because it is innately within every person. Yes some mistakes have great consequences or can be cause great controversies (as in Dawson's case), but it is human nature to make mistakes. Either someone is working in a science lab or in a law office, both are bound to make mistakes. It would be nice to take this factor out of science because that would deliver more consistent results, it is a very unrealistic demand. But considering all the details from this particular case, I have learned to look deeper into any scientific claims made by anyone. Looking at more than one perspective would probably be a better to learn about the truth. Science is objective so the observer and or learner must be objective to get the best out of science.

Analogy and Homology

 All species are related to one another regardless of what they look like or which traits they posses. If a person were to go back far enough in time they would see this relationship. There are two ways to explain why two species have similar traits, some which can be seen on the surface others which are more internal.

First way to explain would be to use homology. There is a prime example of human forelimbs (arm) and the forelimbs of a bat's wing. Human beings are known as Homo sapiens. They are the only living species of homo genus. Their closest living relative is the chimpanzee. They are know to have the ability to create such expression as language, reasoning, culture etc. The other spices would be bats. Their scientific name is Chiroptera. There are the only mammals known to have true flight, because of their forelimbs in their wings. Most are fruit eaters, they are present almost all over the world. A bat, a human, an alligator, and a penguin all evolved from a common ancestor, then they should share common anatomical traits. Looking at the forelimbs of the human, and the bat you will find the humerus, radius, ulna, and carpals in each forelimb. Though the limbs look strikingly different on the outside and though they vary in function, they are very similar in skeletal structure. The forelimb of the human beings have a function to be able to reach objects using the mechanisms of the arm and the hands. While the function of the forelimb of a bat's wing is to help them take flight. More significantly, they come from the same structures in the embryo. Although humans and bats seem to have nothing in common their comparison of homologous structures indicates that they are quite similar. Although there has not been a connection made to who is the common ancestor but by looking at the homologous structure suggests that these two species evolved from a common ancestor. The homo sapiens and Chiropteras have one homologous trait which being the forelimb of a human being and a forelimb of a bat's wing.

An example of analogous trait if compared to the human forelimb would be a dolphin's fin. Dolphins are marine mammals closely related to whales. They vary in size and can be found mostly along the continental shelves. They eat fish and squid. They are among the most intelligent animals. The forelimbs of a dolphin are anatomically equivalent to the forelimbs are analogous to arms in humans. But the bones within the forelimbs of dolphins have been shortened and made more rigid by supporting connective tissue. Pectoral flippers enable dolphins to steer and control their speed. The dolphin seem to have a very similar structure to the forelimb of a human being but just shorter. They both have phalanges, carpals, ulna, and humerus. But unlike the human arm, a dolphin fin is not flexible, it can not be bended or shaped. Dolphins have evolved from Cetaceans and if looked at their skeletal structure there are toes, fingers and thumbs, just like the humans have, which later evolved into flippers and tails.

Try this one!

My DNA Strand:
AAATACCACGCAAGCCCCAGTTCCAAATTGTCTATCTTTT

Good Luck!

Historical Influences on Darwin.

Alfred Russel Wallace had the most influence over Darwin's development of his theory of Natural selection. Alfred Wallace independently come up with the idea of Natural selection, just as Darwin did. His idea was very similar to Darwin as he too believed in species evolving over time. Wallace went on his own trips, one to the Brazilian Amazon in 1848 and the other to Malaysia and Indonesia. He discovered the Wallace Line which he described as the boundary between Australia and Asia where big changes in animals were found. He then wrote a letter to Darwin describing the changes and how that sets as evidence to the evolutionary theory both scientists were working on at the time.

The ideas which are very evident in the work of Alfred Wallace are: All organisms have the potential to reproduce, all organisms have needs which are called “resources” (this came to Wallace after reading and being influenced by Thomas Malthus' views on economics, the idea of pressure of population growth where little earthworms are crashed by big animals and therefore declining their population growth.  Resources are limited, organisms with better access to resources will be more successful, traits must be inherited in order to evolve, Wallace believed in the selection of traits where he believed that the animal/organisms with better traits have a better chance at surviving, existing, and reproducing. Lastly Wallace believed selection occurred by groups and not individuals. Charles Darwin believed in much of these ideas, he built upon on all these ideas. Since his theory was very much similar to Wallace, Darwin supported most of these beliefs, except Darwin did not believe that selection occurred in groups, he believed it was solely on an individual.

 Darwin could have not developed his theory of natural selection without the influence of Alfred Wallace because, Wallace reported back to Darwin. Wallace brought back bird samples for Darwin to use on his experiment. Darwin used the findings of Wallace as evidence for his theory. Also it was knowing that Wallace has discovered a similar idea to him that pushed Darwin to publish his work.

The church was a great believer in creationism, they did not like the idea of evolution which Darwin brought out. Darwin was afraid about being criticized for his work by the church especially remembering the execution of Galileo for saying the sun was the center of the sun. Darwin worked for a very long time before finally publishing his book so he can include as much detail and evidence he possibly can to prove his theory.


Links:  http://www.christs.cam.ac.uk/darwin200/pages/index.php?page_id=d8

http://evolution.berkeley.edu/evolibrary/article/history_14